Review





Similar Products

86
Sangon Biotech actb 3 utr
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Actb 3 Utr, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pmc13254979-402-6-11?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
actb 3 utr - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech mutant mut hif1a hif1a 3 utr fragments
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Mutant Mut Hif1a Hif1a 3 Utr Fragments, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm42316286-103-4-17?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
mutant mut hif1a hif1a 3 utr fragments - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

utr  (ATCC)
99
ATCC utr
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Utr, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm42287637-124-35-19?v=ATCC
Average 99 stars, based on 1 article reviews
utr - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
OriGene ganab 3 utr luciferase reporter construct
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Ganab 3 Utr Luciferase Reporter Construct, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm42258751-242-1-12?v=OriGene
Average 94 stars, based on 1 article reviews
ganab 3 utr luciferase reporter construct - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
OriGene origene rplp0 forward
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Origene Rplp0 Forward, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/bio_rxiv__64898__2026__05__21__726749-108-5-5?v=OriGene
Average 94 stars, based on 1 article reviews
origene rplp0 forward - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Genecopoeia mirna 3´utr target expression clone for human myb
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Mirna 3´Utr Target Expression Clone For Human Myb, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/custom%40hmit157288-mt05%4042048347?v=Genecopoeia
Average 93 stars, based on 1 article reviews
mirna 3´utr target expression clone for human myb - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Genecopoeia znf24 3 utr
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Znf24 3 Utr, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm41977380-323-11-13?v=Genecopoeia
Average 93 stars, based on 1 article reviews
znf24 3 utr - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Genecopoeia znf24 overexpression
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Znf24 Overexpression, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm41977380-323-18-20?v=Genecopoeia
Average 93 stars, based on 1 article reviews
znf24 overexpression - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Genecopoeia control vector
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Control Vector, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm41977380-323-15-13?v=Genecopoeia
Average 93 stars, based on 1 article reviews
control vector - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
OriGene ifit3 agctcctctctaactcagagcaac ccactgcaggcttctgatg calonge
Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of <t>3′UTR-containing</t> vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.
Ifit3 Agctcctctctaactcagagcaac Ccactgcaggcttctgatg Calonge, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3+utr/pm41973907-291-22-53?v=OriGene
Average 94 stars, based on 1 article reviews
ifit3 agctcctctctaactcagagcaac ccactgcaggcttctgatg calonge - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of 3′UTR-containing vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.

Journal: iScience

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex

doi: 10.1016/j.isci.2026.116234

Figure Lengend Snippet: Reconstitution of RBM46-MEIOC-YTHDC2 functions in somatic cells (A–C) Diagram of 3′UTR-containing vectors. Rad21 , Meioc , and Ccna2 3′UTR sequences were inserted downstream of EGFP, respectively. (D–F) Representative western blotting pictures showing EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. Plasmid vectors shown at the top of each blot were transfected into HEK293T cells. N = 3. Minus signs (−) indicate empty vector controls. (G–I) Comparative EGFP expression in the presence or absence of RBM46, MEIOC, and YTHDC2. EGFP expression was normalized to β-Actin. N = 3. (J–L) RT-qPCR analysis showing relative mRNA levels of EGFP with Rad21 , Meioc , or Ccna2 3′UTR under the indicated conditions. The cells were collected 48 h after transfection. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.

Article Snippet: DNA template with SP6 promoter for Actb 3′UTR was synthesized from Sangon Biotech.

Techniques: Western Blot, Expressing, Plasmid Preparation, Transfection, Quantitative RT-PCR

Determination of RBM46-MEIOC-YTHDC2-targeting motif in the Rad21 and Meioc 3′UTR (A) Diagram of firefly luciferase reporter containing the 3′UTR of interest. This backbone vector contains poly(A) signals downstream of firefly luciferase reporter gene. (B) Schematic illustration of the workflow of the luciferase experiment. (C) Full-length and truncated Rad21 3′UTR constructs (ΔF1 to ΔF7). (D) Dual luciferase activities of the indicated constructs (ΔF1 to ΔF4) were measured 48 h after transfection, N = 3. (E) Relative luciferase activities of the indicated constructs (ΔF5 to ΔF7), N = 3. (F) Full-length and truncated Meioc 3′UTR constructs (ΔD1 to ΔD7). (G) Relative luciferase activities from the indicated constructs (ΔD1 to ΔD4), N = 3. (H) Relative luciferase activities of the indicated constructs (ΔD5 to ΔD7), N = 3. (I) Consensus sequence of ΔF5, ΔF7, and ΔD5 fragments was analyzed using the STREME algorithm. This sequence contains RBM46 binding motif AAUCAU identified by eCLIP using mouse testes and is similar to the consensus sequence identified by an in vitro RBM46 binding assay. (J) Mut-ΔF5 construct were generated by deletion of consensus sequence in ΔF5. Compared to ΔF5, the luciferase activities were rescued in cells transfected with Mut-ΔF5, N = 3. (K) Relative luciferase activities from Mut-ΔD5 construct were derepressed, N = 3. (L) Relative luciferase activities from Mut- Actb were repressed by RMY complex. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.

Journal: iScience

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex

doi: 10.1016/j.isci.2026.116234

Figure Lengend Snippet: Determination of RBM46-MEIOC-YTHDC2-targeting motif in the Rad21 and Meioc 3′UTR (A) Diagram of firefly luciferase reporter containing the 3′UTR of interest. This backbone vector contains poly(A) signals downstream of firefly luciferase reporter gene. (B) Schematic illustration of the workflow of the luciferase experiment. (C) Full-length and truncated Rad21 3′UTR constructs (ΔF1 to ΔF7). (D) Dual luciferase activities of the indicated constructs (ΔF1 to ΔF4) were measured 48 h after transfection, N = 3. (E) Relative luciferase activities of the indicated constructs (ΔF5 to ΔF7), N = 3. (F) Full-length and truncated Meioc 3′UTR constructs (ΔD1 to ΔD7). (G) Relative luciferase activities from the indicated constructs (ΔD1 to ΔD4), N = 3. (H) Relative luciferase activities of the indicated constructs (ΔD5 to ΔD7), N = 3. (I) Consensus sequence of ΔF5, ΔF7, and ΔD5 fragments was analyzed using the STREME algorithm. This sequence contains RBM46 binding motif AAUCAU identified by eCLIP using mouse testes and is similar to the consensus sequence identified by an in vitro RBM46 binding assay. (J) Mut-ΔF5 construct were generated by deletion of consensus sequence in ΔF5. Compared to ΔF5, the luciferase activities were rescued in cells transfected with Mut-ΔF5, N = 3. (K) Relative luciferase activities from Mut-ΔD5 construct were derepressed, N = 3. (L) Relative luciferase activities from Mut- Actb were repressed by RMY complex. N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction.

Article Snippet: DNA template with SP6 promoter for Actb 3′UTR was synthesized from Sangon Biotech.

Techniques: Luciferase, Plasmid Preparation, Construct, Transfection, Sequencing, Binding Assay, In Vitro, Generated

RBM46 requires RNA binding via its own RRMs to interact with YTHDC2 (A) Schematic diagram of the RBM46 structural domain deletion constructs. (B) CoIP assay for the interaction of MEIOC with RBM46 mutants (M1-M4) in HEK293T cells. Representative images on the left and statistical analysis on the right, N = 3. M3 and M4 showed weak interaction with MEIOC. (C) CoIP assay for the interaction of YTHDC2 with RBM46 mutants (M1-M4). Representative images on the left and statistical analysis on the right, N = 3. M2 revealed weak interaction with YTHDC2. (D) RIP-qPCR analysis of F-Luc-Rad21 3′UTR in HEK293T cells transfected with RBM46 mutants, N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction. (E) CoIP assay for the interaction of YTHDC2 with RBM46 using purified FLAG-YTHDC2, HA-RBM46, Rad21 3′UTR, and Actb 3′UTR, N = 2. (F) Functional analysis of RBM46 mutants in the reconstituted system, N = 3. Representative images were showed.

Journal: iScience

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex

doi: 10.1016/j.isci.2026.116234

Figure Lengend Snippet: RBM46 requires RNA binding via its own RRMs to interact with YTHDC2 (A) Schematic diagram of the RBM46 structural domain deletion constructs. (B) CoIP assay for the interaction of MEIOC with RBM46 mutants (M1-M4) in HEK293T cells. Representative images on the left and statistical analysis on the right, N = 3. M3 and M4 showed weak interaction with MEIOC. (C) CoIP assay for the interaction of YTHDC2 with RBM46 mutants (M1-M4). Representative images on the left and statistical analysis on the right, N = 3. M2 revealed weak interaction with YTHDC2. (D) RIP-qPCR analysis of F-Luc-Rad21 3′UTR in HEK293T cells transfected with RBM46 mutants, N = 3. Data are presented as mean ± SEM. p values were determined by one-way ANOVA with Benjamini-Hochberg correction. (E) CoIP assay for the interaction of YTHDC2 with RBM46 using purified FLAG-YTHDC2, HA-RBM46, Rad21 3′UTR, and Actb 3′UTR, N = 2. (F) Functional analysis of RBM46 mutants in the reconstituted system, N = 3. Representative images were showed.

Article Snippet: DNA template with SP6 promoter for Actb 3′UTR was synthesized from Sangon Biotech.

Techniques: RNA Binding Assay, Construct, Co-Immunoprecipitation Assay, Transfection, Purification, Functional Assay

XRN2 is a new partner of MEIOC and involved in RMY-dependent RNA repression (A) Immunoprecipitated MEIOC complexes were separated by SDS-PAGE and the protein in the gel was stained with silver prior to mass spectrometry (MS). (B) Related proteins in MEIOC complex were identified by MS. (C) Cytoplasm and nuclei were separated from HEK293T cells transfected with MEIOC and YTHDC2 (M + Y). Lamin B1 was used as a nuclear marker and GADPH as a cytoplasmic marker, N = 3. (D) XRN2 protein was co-immunoprecipitated with MEIOC. IgG was used as a negative control. N = 3. (E) Western blot analysis of MEIOC and XNR2 protein. A lentivirus containing HIS-MEIOC infected HEK293T cells. The cells were lysed with RIPA buffer and then coIP assay was performed with anti-XRN2 antibody. IgG was used as a negative control. N = 3. (F) Western blot analysis of XRN2 and β-Actin from HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (G) RT-qPCR analysis showing relative mRNA levels of XRN2 in HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (H) Relative luciferase activities of F-Luc-Rad21 3′UTR in HEK293T cells after knockdown of XRN2 only or combined with the expression of RBM46, MEIOC and YTHDC2 (RMY). N = 3. Data are presented as mean ± SEM. p values were determined by unpaired t test with Welch’s correction (C–E) or by one-way ANOVA with Benjamini-Hochberg correction (F–H). (I) A model of RMY complex assembly and target mRNA degradation.

Journal: iScience

Article Title: A mechanism of target mRNA selection and activity regulation in meiosis-related RBM46-MEIOC-YTHDC2 complex

doi: 10.1016/j.isci.2026.116234

Figure Lengend Snippet: XRN2 is a new partner of MEIOC and involved in RMY-dependent RNA repression (A) Immunoprecipitated MEIOC complexes were separated by SDS-PAGE and the protein in the gel was stained with silver prior to mass spectrometry (MS). (B) Related proteins in MEIOC complex were identified by MS. (C) Cytoplasm and nuclei were separated from HEK293T cells transfected with MEIOC and YTHDC2 (M + Y). Lamin B1 was used as a nuclear marker and GADPH as a cytoplasmic marker, N = 3. (D) XRN2 protein was co-immunoprecipitated with MEIOC. IgG was used as a negative control. N = 3. (E) Western blot analysis of MEIOC and XNR2 protein. A lentivirus containing HIS-MEIOC infected HEK293T cells. The cells were lysed with RIPA buffer and then coIP assay was performed with anti-XRN2 antibody. IgG was used as a negative control. N = 3. (F) Western blot analysis of XRN2 and β-Actin from HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (G) RT-qPCR analysis showing relative mRNA levels of XRN2 in HEK293T cells transfected with XRN2 siRNAs and control siRNA, N = 3. (H) Relative luciferase activities of F-Luc-Rad21 3′UTR in HEK293T cells after knockdown of XRN2 only or combined with the expression of RBM46, MEIOC and YTHDC2 (RMY). N = 3. Data are presented as mean ± SEM. p values were determined by unpaired t test with Welch’s correction (C–E) or by one-way ANOVA with Benjamini-Hochberg correction (F–H). (I) A model of RMY complex assembly and target mRNA degradation.

Article Snippet: DNA template with SP6 promoter for Actb 3′UTR was synthesized from Sangon Biotech.

Techniques: Immunoprecipitation, SDS Page, Staining, Mass Spectrometry, Transfection, Marker, Negative Control, Western Blot, Infection, Co-Immunoprecipitation Assay, Control, Quantitative RT-PCR, Luciferase, Knockdown, Expressing